RL3(t), Responsible for Leaf Shape Formation, Delimited to a 46-kb DNA Fragment in Rice

doi:10.1016/S1672-6308(14)60276-6

Abstract

Abstract:

Two mutants with rolled leaves, temporally designated as rl3(t)-1 and rl3(t)-2, were served for exploring the mechanism underlying the rolled leaf characteristic. Except for having typical rolled leaves, the plant heights and panicle lengths of rl3(t)-1 and rl3(t)-2 significantly decreased, and the seed-setting rate also decreased when compared with wild type 93-11. Cytological analysis suggested that the rolled leaf phenotype might be caused by the changes of number and size of bulliform cells. Genetic analysis indicated rl3(t)-1 is allelic to rl3(t)-2, and controlled by a recessive gene. Gene mapping result indicated that RL3(t) gene resided in a 46-kb long region governed by the sequence tag site markers S3-39 and S3-36 on rice chromosome 3. The result provides an important clue for further cloning the RL3(t) and understanding the mechanism of rice leaf development.

Key words: gene mapping, leaf shape formation, mutant, rice, rolled leaf gene

Min Guo, Rong-de Li, Jian Yao, Juan Zhu, Xiang-yun Fan, Wei Wang, Shu-zhu Tang, Ming-hong Gu, Chang-jie Yan. RL3(t), Responsible for Leaf Shape Formation, Delimited to a 46-kb DNA Fragment in Rice[J]. Rice Science, 2015, 22(1): 44-48.

Figures/Tables 6

Fig. 1. Phenotype of wild type 93-11, and mutants rl3(t)-1 and rl3(t)-2. A, Gross plant at seedling stage (50 d after seeding); B, Flag leaves; C, Gross plant at heading stage; D, Panicles; E, Plant height; F, Panicle length; G, No. of grains per panicle; H, Seed-setting rate. * and **, Significance at 0.05 and 0.01 levels, respectively.

Fig. 2. Numbers of large vascular (A) and small vascular (B) in leaves of 93-11 and rl3(t)-1 mutant.

Fig. 3. Hand-sections of wild type 93-11 and rl3(t)-1 mutant leaves under fluorescence microscope.

Table 1 Performance of F1 and the segregation in F2 populations.

Cross	F₁	F₂			χ² (3:1)
Cross	F₁	Normal plants	Mutation plants	Total	χ² (3:1)
93-11/rl3(t) -1	Normal	1538	312	1850	67.93**
Wuyunjing 8/rl3(t) -1	Normal	499	46	540	86.34**
rl3(t)-2/93-11	Normal	768	114	882	64.86**
rl3(t)-2/Wuyunjing 8	Normal	682	78	760	87.24**

Fig. 4. Fine mapping of RL3(t) gene.A, The RL3(t) gene was mapped to the region between M3-45 and RM6676 on chromosome 3 (Chr3) based on 46 recessive plants from F2 population (WYJ8/rl3(t)-1); B, For fine mapping of RL3(t), 430 recessive individuals from F3 progeny were employed together with new-developed molecular markers, and the target region was narrowed to a 46-kb long region governed by S3-39 and S3-36.

Table 2 New-developed molecular markers in present study.

Marker	Primer sequence (5′-3′)	Location
M3-28	F: TATCACCGAGACATAAACAAAC	AC137547
M3-28	R: GAATAGTCCCAATGGAGAAAT	AC137547
M3-13	F: TATCAAGAGGGGAAAGCC	AC121491
M3-13	R: ACATCCGACAAAGACAGG	AC121491
M3-16	F: AGGTGACTTTCCTCTTGC	AC136284
M3-16	R: TACATTGGGTATGGTGGT	AC136284
S3-39	F: AGCAGAGGCTCCATCAG	AC135257
S3-39	R: TCTTCCTTCACCCTTCAT	AC135257
S3-36	F: CTACCGTGCTGCCGAAGA	AC135257
S3-36	R: CGGATGATGGATGGAAAT	AC135257
S3-41	F: ACCGCAGCACTGAGAAGG	AC136284
S3-41	R: AAGAGGGGAAGGCGAGAT	AC136284

References 23

1	Chen D B, Cheng S H, Cao L Y.2010. Research progress on narrow leaf trait in rice.China Rice, 16(3): 1-4. (in Chinese)
2	Chen W F, Xu Z J, Zhang L B.1989. Research on rice ideotype.J Shenyang Agric Univ, 20(4): 417-420. (in Chinese)
3	Fang L K, Zhao F M, Cong Y F, Song X C, Du Q, Wang D Z, Li Y F, Ling Y H, Yang Z L, He G H.2012. Rolling-leaf14 is a 2OG-Fe (II) oxygenase family protein that modulates rice leaf rolling by affecting secondary cell wall formation in leaves.Plant Biotechnol J, 10(5): 524-532.
4	Gao Y H, Lv C G.2006. Status of studies on rice rolled leaf.J Jinling Inst Technol, 1: 62-66. (in Chinese with English abstract)
5	Hibara K, Obara M, Hayashida E, Abe M, Ishimaru T, Satoh H, Itoh J, Nagato Y.2009. The ADAXIALIZED LEAF1 gene functions in leaf and embryonic pattern formation in rice.Dev Biol, 334(2): 345-354.
6	Kang W Q, Ouyang Y N, Dong C Q, Zhu L F, Yu S M, Xu D H, Jiu Q Y.2007. Discussion on the mode and index for rice dynamic plant type.China Rice, 13(1): 1-6. (in Chinese)
7	Kinoshita T.1990. Report of the committee on gene symbolization, nomenclature and linkage groups.Rice Genet Newsl, 7: 16-50.
8	Li L, Shi Z Y, Li L, Shen G Z, Wang X Q, An L S, Zhang J L.2010. Overexpression of ACL1 (abaxially curled leaf 1) increased bulliform cells and induced abaxial curling of leaf blades in rice.Mol Plant, 3(5): 807-817.
9	Li M, Xiong G Y, Li R, Cui J J, Tang D, Zhang B C, Pauly M, Cheng Z K, Zhou Y H.2009. Rice cellulose synthase-like D4 is essential for normal cell-wall biosynthesis and plant growth.Plant J, 60(6): 1055-1069.
10	Lv C G, Gu F L, Zou J S, Lu M L.1991. Studies on yielding potential and related characterstics of rice ideotype.Sci Agric Sin, 24(5): 15-22. (in Chinese with English abstract)
11	Matsushita S, Iseki T, Fukuta Y, Araki E, Kobayashi S, Osaki M, Yamgishi M.2003. Characterization of segregation distortion on chromosome 3 induced in wide hybridization between indica and japonica type rice varieties.Euphytica, 134: 27-32.
12	Peng Y, Liang Y S, Wang S Q, Wu F Q, Li S C, Deng Q M, Li P.2006. Analysis of segregation distortion of SSR markers in the RI population of rice.Mol Plant Breeding, 4: 786-790. (in Chinese with English abstract)
13	Shi Z Y, Wang J, Wan X S, Shen G Z, Wang X Q, Zhang J L.2007. Over-expression of rice OsAGO7 gene induces upward curling of the leaf blade that enhanced erect-leaf habit.Planta, 226: 99-108.
14	Su Z F, Xu N X, Sun C M, Zhang Y J.2003. Study on the relationship between rice plant type indices after heading stage and yield formation.Sci Agric Sin, 36(1): 115-120. (in Chinese with English abstract)
15	Wang D Z, Sang X C, You X Q, Wang Z, Wang Q Z, Zhao F M, Ling Y H, Li Y F, He G H.2011. Genetic analysis and gene mapping of a novel and rolled leaf mutant nrl2(t) in rice (Oryza sativa L.). Acta Agron Sin, 37(7): 1159-1166. (in Chinese with English abstract)
16	Xiang J J, Zhang G H, Qian Q, Xue H W.2012. Semi-rolled leaf1 encodes a putative glycosylphosphatidylinositol-anchored protein and modulates rice leaf rolling by regulating the formation of bulliform cells.Plant Physiol, 159(4): 1488-1500.
17	Xu Y, Zhu L, Xiao J, Huang N, McCouch S R.1997. Chromosomal regions associated with segregation distortion of molecular markers in F2, backcross, doubled haploid, and recombinant inbred populations in rice (Oryza sativa L.).Mol Gen Genet, 253(3): 535-545.
18	Yan S, Yan C J, Zeng X H, Yang Y C, Fang Y W, Tian C Y, Sun Y W, Cheng Z K, Gu M H.2008.ROLLED LEAF 9, encoding a GARP protein, regulates the leaf abaxial cell fate in rice.Plant Mol Biol, 68(3): 239-250.
19	Yan S, Yan C J, Gu M H.2008. Molecular mechanism of leaf development.Hereditas, 30(9): 1127-1135.
20	Yuan L P.1997. Hybrid rice breeding for super high yield.Hybrid Rice, 12(6): 1-6. (in Chinese)
21	Zhang G H, Xu Qian, Zhu X D, Qian Q, Xue H W.2009. SHALLOT-LIKE1 is a KANADI transcription factor that modulates rice leaf rolling by regulating leaf abaxial cell development.Plant Cell, 21(3): 719-735.
22	Zou L P, Sun X H, Zhang Z G, Liu P, Wu J X, Tian C J, Qiu J L, Lu T G.2011. Leaf rolling controlled by the homeodomain leucine zipper class IV gene ROC5 in rice.Plant Physiol, 156(3): 1589-1602.
23	Zuo J R, Li J Y.2014. Molecular dissection of complex agronomic traits of rice: A team effort by Chinese scientists in recent years.Nat Sci Rev, 1: 253-276.

[1]	Prathap V, Suresh KUMAR, Nand Lal MEENA, Chirag MAHESHWARI, Monika DALAL, Aruna TYAGI. Phosphorus Starvation Tolerance in Rice Through a Combined Physiological, Biochemical and Proteome Analysis [J]. Rice Science, 2023, 30(6): 8-.
[2]	Serena REGGI, Elisabetta ONELLI, Alessandra MOSCATELLI, Nadia STROPPA, Matteo Dell’ANNO, Kiril PERFANOV, Luciana ROSSI. Seed-Specific Expression of Apolipoprotein A-I_Milano Dimer in Rice Engineered Lines [J]. Rice Science, 2023, 30(6): 6-.
[3]	Sundus ZAFAR, XU Jianlong. Recent Advances to Enhance Nutritional Quality of Rice [J]. Rice Science, 2023, 30(6): 4-.
[4]	Kankunlanach KHAMPUANG, Nanthana CHAIWONG, Atilla YAZICI, Baris DEMIRER, Ismail CAKMAK, Chanakan PROM-U-THAI. Effect of Sulfur Fertilization on Productivity and Grain Zinc Yield of Rice Grown under Low and Adequate Soil Zinc Applications [J]. Rice Science, 2023, 30(6): 9-.
[5]	FAN Fengfeng, CAI Meng, LUO Xiong, LIU Manman, YUAN Huanran, CHENG Mingxing, Ayaz AHMAD, LI Nengwu, LI Shaoqing. Novel QTLs from Wild Rice Oryza longistaminata Confer Rice Strong Tolerance to High Temperature at Seedling Stage [J]. Rice Science, 2023, 30(6): 14-.
[6]	XIA Xiaodong, ZHANG Xiaobo, WANG Zhonghao, CHENG Benyi, Sun Huifeng, XU Xia, GONG Junyi, YANG Shihua, WU Jianli, SHI Yongfeng, XU Rugen. Mapping and Functional Analysis of LE Gene in a Lethal Etiolated Rice Mutant at Seedling Stage [J]. Rice Science, 2023, 30(6): 13-.
[7]	LIN Shaodan, YAO Yue, LI Jiayi, LI Xiaobin, MA Jie, WENG Haiyong, CHENG Zuxin, YE Dapeng. Application of UAV-Based Imaging and Deep Learning in Assessment of Rice Blast Resistance [J]. Rice Science, 2023, 30(6): 10-.
[8]	Md. Forshed DEWAN, Md. AHIDUZZAMAN, Md. Nahidul ISLAM, Habibul Bari SHOZIB. Potential Benefits of Bioactive Compounds of Traditional Rice Grown in South and South-East Asia: A Review [J]. Rice Science, 2023, 30(6): 5-.
[9]	Raja CHAKRABORTY, Pratap KALITA, Saikat SEN. Phenolic Profile, Antioxidant, Antihyperlipidemic and Cardiac Risk Preventive Effect of Chakhao Poireiton (A Pigmented Black Rice) in High-Fat High-Sugar induced Rats [J]. Rice Science, 2023, 30(6): 11-.
[10]	LI Qianlong, FENG Qi, WANG Heqin, KANG Yunhai, ZHANG Conghe, DU Ming, ZHANG Yunhu, WANG Hui, CHEN Jinjie, HAN Bin, FANG Yu, WANG Ahong. Genome-Wide Dissection of Quan 9311A Breeding Process and Application Advantages [J]. Rice Science, 2023, 30(6): 7-.
[11]	JI Dongling, XIAO Wenhui, SUN Zhiwei, LIU Lijun, GU Junfei, ZHANG Hao, Tom Matthew HARRISON, LIU Ke, WANG Zhiqin, WANG Weilu, YANG Jianchang. Translocation and Distribution of Carbon-Nitrogen in Relation to Rice Yield and Grain Quality as Affected by High Temperature at Early Panicle Initiation Stage [J]. Rice Science, 2023, 30(6): 12-.
[12]	Nazaratul Ashifa Abdullah Salim, Norlida Mat Daud, Julieta Griboff, Abdul Rahim Harun. Elemental Assessments in Paddy Soil for Geographical Traceability of Rice from Peninsular Malaysia [J]. Rice Science, 2023, 30(5): 486-498.
[13]	Ammara Latif, Sun Ying, Pu Cuixia, Noman Ali. Rice Curled Its Leaves Either Adaxially or Abaxially to Combat Drought Stress [J]. Rice Science, 2023, 30(5): 405-416.
[14]	Liu Qiao, Qiu Linlin, Hua Yangguang, Li Jing, Pang Bo, Zhai Yufeng, Wang Dekai. LHD3 Encoding a J-Domain Protein Controls Heading Date in Rice [J]. Rice Science, 2023, 30(5): 437-448.
[15]	Lu Xuedan, Li Fan, Xiao Yunhua, Wang Feng, Zhang Guilian, Deng Huabing, Tang Wenbang. Grain Shape Genes: Shaping the Future of Rice Breeding [J]. Rice Science, 2023, 30(5): 379-404.