Comprehensive Characteristics of MicroRNA Expression Profile Conferring to Rhizoctonia solani in Rice

doi:10.1016/j.rsci.2019.04.007

摘要/Abstract

. [J]. Rice Science, 2020, 27(2): 101-112.

图/表 16

参考文献 78

[1]	Arikit S, Zhai J X, Meyers B C. 2013. Biogenesis and function of rice small RNAs from non-coding RNA precursors. Curr Opin Plant Biol, 16(2): 170-179.
[2]	Aukerman M J, Sakai H. 2003. Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes. Plant Cell, 15(11): 2730-2741.
[3]	Axtell M J. 2013. Classification and comparison of small RNAs from plants. Annu Rev Plant Biol, 64: 137-159.
[4]	Baldrich P, Campo S, Wu M T, Liu T T, Hsing Y L, San Segundo B. 2015. MicroRNA-mediated regulation of gene expression in the response of rice plants to fungal elicitors. RNA Biol, 12(8): 847-863.
[5]	Barrera-Figueroa B E, Gao L, Wu Z G, Zhou X F, Zhu J H, Jin H L, Liu R Y, Zhu J K. 2012. High throughput sequencing reveals novel and abiotic stress-regulated microRNAs in the inflorescences of rice. BMC Plant Biol, 12: 132.
[6]	Bartel D P. 2004. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell, 116(2): 281-297.
[7]	Baulcombe D. 2004. RNA silencing in plants. Nature, 431: 356-363.
[8]	Boccara M, Sarazin A, Thiebeauld O, Jay F, Voinnet O, Navarro L, Colot V. 2014. The Arabidopsis miR472-RDR6 silencing pathway modulates PAMP- and effector-triggered immunity through the post-transcriptional control of disease resistance genes. PLoS Pathog, 10(1): e1003883.
[9]	Boller T, Felix G. 2009. A renaissance of elicitors: Perception of microbe-associated molecular patterns and danger signals by pattern-recognition receptors. Ann Rev Plant Biol, 60: 379-406.
[10]	Brodersen P, Sakvarelidze-Achard L, Bruun-Rasmussen M, Dunoyer P, Yamamoto Y Y, Sieburth L, Voinnet O. 2008. Widespread translational inhibition by plant miRNAs and siRNAs. Science, 320: 1185-1190.
[11]	Campo S, Peris-Peris C, Sire C, Moreno A B, Donaire L, Zytnicki M, Notredame C, Llave C, San Segundo B. 2013. Identification of a novel microRNA (miRNA) from rice that targets an alternatively spliced transcript of the Nramp6 (Natural resistance-associated macrophage protein 6) gene involved in pathogen resistance. New Phytol, 199(1): 212-227.
[12]	Cao S J, Zhu Q H, Shen W X, Jiao X M, Zhao X C, Wang M B, Liu L X, Singh S P, Liu Q. 2013. Comparative profiling of miRNA expression in developing seeds of high linoleic and high oleic safflower (Carthamus tinctorius L.) plants. Front Plant Sci, 4: 489.
[13]	Carthew R W, Sontheimer E J. 2009. Origins and mechanisms of miRNAs and siRNAs. Cell, 136(4): 642-655.
[14]	Cheah B H, Nadarajah K, Divate M D, Wickneswari R. 2015. Identification of four functionally important microRNA families with contrasting differential expression profiles between drought-tolerant and susceptible rice leaf at vegetative stage. BMC Genom, 16(1): 692.
[15]	Chen F, Li Q, He Z H. 2007. Proteomic analysis of rice plasma membrane-associated proteins in response to chitooligo- saccharide elicitors. J Integr Plant Biol, 49(6): 863-870.
[16]	Chen X J, Chen Y, Zhang L N, Xu B, Zhang J H, Chen Z X, Tong Y H, Zuo S M, Xu J Y. 2016. Overexpression of OsPGIP1 enhances rice resistance to sheath blight. Plant Dis, 100(2): 388-395.
[17]	Fei Q L, Xia R, Meyers B C. 2013. Phased, secondary, small interfering RNAs in posttranscriptional regulatory networks. Plant Cell, 25(7): 2400-2415.
[18]	Ghildiyal M, Zamore P D. 2009. Small silencing RNAs: An expanding universe. Nat Rev Genet, 10(2): 94-108.
[19]	Ito T M, Polido P B, Rampim M C, Kaschuk G, Souza S G H. 2014. Genome-wide identification and phylogenetic analysis of the AP2/ERF gene superfamily in sweet orange (Citrus sinensis). Genet Mol Res, 13(3): 7839-7851.
[20]	Jiang S F, Wang C J Z, Shu C W, Zhou E X. 2018. Cloning and expression analysis of RsPhm gene in Rhizoctonia solani AG-1IA of rice sheath blight pathogen. Chin J Rice Sci, 32(2): 111-118. (in Chinese with English abstract)
[21]	Jones J D G, Dangl J L. 2006. The plant immune system. Nature, 444: 323-329.
[22]	Jones-Rhoades M W, Bartel D P. 2004. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Mol Cell, 14(6): 787-799.
[23]	Karmakar S, Molla K A, Chanda P K, Sarkar S N, Datta S K, Datta K. 2016. Green tissue-specific co-expression of chitinase and oxalate oxidase 4 genes in rice for enhanced resistance against sheath blight. Planta, 243(1): 115-130.
[24]	Kozomara A, Griffiths-Jones S. 2014. miRBase: Annotating high confidence microRNAs using deep sequencing data. Nucl Acids Res, 42: D68-D73.
[25]	Li T, Li H, Zhang Y X, Liu J Y. 2011. Identification and analysis of seven H2O2-responsive miRNAs and 32 new miRNAs in the seedlings of rice (Oryza sativa L. ssp indica). Nucl Acids Res, 39(7): 2821-2833.
[26]	Li Z Y, Xia J, Chen Z, Yu Y, Li Q F, Zhang Y C, Zhang J P, Wang C Y, Zhu X Y, Zhang W, Chen Y Q. 2016. Large-scale rewiring of innate immunity circuitry and microRNA regulation during initial rice blast infection. Sci Rep, 6: 25493.
[27]	Lin R M, He L Y, He J Y, Qin P G, Wang Y R, Deng Q M, Yang X T, Li S C, Wang S Q, Wang W M, Liu H N, Li P, Zheng A P. 2016. Comprehensive analysis of microRNA-seq and target mRNAs of rice sheath blight pathogen provides new insights into pathogenic regulatory mechanisms. DNA Res, 23(5): 415-425.
[28]	Liu W D, Liu J L, Triplett L, Leach J E, Wang G L. 2014. Novel insights into rice innate immunity against bacterial and fungal pathogens. Ann Rev Phytopathol, 52: 213-241.
[29]	Llave C, Kasschau K D, Rector M A, Carrington J C. 2002a. Endogenous and silencing-associated small RNAs in plants. Plant Cell, 14(7): 1605-1619.
[30]	Llave C, Xie Z X, Kasschau K D, Carrington J C. 2002b. Cleavage of scarecrow-like mRNA targets directed by a class of Arabidopsis miRNA. Science, 297: 2053-2056.
[31]	Manavella P A, Koenig D, Weigel D. 2012. Plant secondary siRNA production determined by microRNA-duplex structure. Proc Natl Acad Sci USA, 109(7): 2461-2466.
[32]	Matzke M A, Mosher R A. 2014. RNA-directed DNA methylation: An epigenetic pathway of increasing complexity. Nat Rev Genet, 15(6): 394-408.
[33]	Merico D, Isserlin R, Stueker O, Emili A, Bader G D. 2010. Enrichment map: A network-based method for gene-set enrichment visualization and interpretation. PLoS One, 5(11): e13984.
[34]	Mi S J, Cai T, Hu Y G, Chen Y M, Hodges E, Ni F R, Wu L, Li S, Zhou H Y, Long C Z, Chen S, Hannon G J, Qi Y J. 2008. Sorting of small RNAs into Arabidopsis argonaute complexes is directed by the 5'-terminal nucleotide. Cell, 133(1): 116-127.
[35]	Montgomery T A, Howell M D, Cuperus J T, Li D W, Hansen J E, Alexander A L, Chapman E J, Fahlgren N, Allen E, Carrington J C. 2008. Specificity of ARGONAUTE7-miR390 interaction and dual functionality in TAS3 trans-acting siRNA formation. Cell, 133(1): 128-141.
[36]	Mutum R D, Kumar S, Balyan S, Kansal S, Mathur S, Raghuvanshi S. 2016. Identification of novel miRNAs from drought tolerant rice variety Nagina 22. Sci Rep, 6: 30786.
[37]	Navarro L, Dunoyer P, Jay F, Arnold B, Dharmasiri N, Estelle M, Voinnet O, Jones J D. 2006. A plant miRNA contributes to antibacterial resistance by repressing auxin signaling. Science, 312: 436-439.
[38]	Nischal L, Mohsin M, Khan I, Kardam H, Wadhwa A, Abrol Y P, Iqbal M, Ahmad A. 2012. Identification and comparative analysis of microRNAs associated with low-N tolerance in rice genotypes. PLoS One, 7(12): e50261.
[39]	Ouyang S Q, Park G, Atamian H S, Han C S, Stajich J E, Kaloshian I, Borkovich K A. 2014. MicroRNAs suppress NB domain genes in tomato that confer resistance to Fusarium oxysporum. PLoS Pathog, 10(10): e1004464.
[40]	Padmanabhan C, Zhang X M, Jin H L. 2009. Host small RNAs are big contributors to plant innate immunity. Curr Opin Plant Biol, 12(4): 465-472.
[41]	Palatnik J F, Allen E, Wu X, Schommer C, Schwab R, Carrington J C, Weigel D. 2003. Control of leaf morphogenesis by microRNAs. Nature, 425: 257-263.
[42]	Park W, Li J J, Song R T, Messing J, Chen X M. 2002. CARPEL FACTORY, a dicer homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana. Curr Biol, 12(17): 1484-1495.
[43]	Peng T, Sun H Z, Qiao M M, Zhao Y F, Du Y X, Zhang J, Li J Z, Tang G L, Zhao Q Z. 2014. Differentially expressed microRNA cohorts in seed development may contribute to poor grain filling of inferior spikelets in rice. BMC Plant Biol, 14: 196.
[44]	Peng X X, Hu Y J, Tang X K, Zhou P L, Deng X B, Wang H H, Guo Z J. 2012. Constitutive expression of rice WRKY30 gene increases the endogenous jasmonic acid accumulation, PR gene expression and resistance to fungal pathogens in rice. Planta, 236(5): 1485-1498.
[45]	Peng X X, Wang H H, Jang J C, Xiao T, He H H, Jiang D, Tang X K. 2016. OsWRKY80-OsWRKY4 module as a positive regulatory circuit in rice resistance against Rhizoctonia solani. Rice, 9: 63.
[46]	Pooja S, Sweta K, Mohanapriya A, Sudandiradoss C, Siva R, Gothandam K M, Babu S. 2015. Homotypic clustering of OsMYB4 binding site motifs in promoters of the rice genome and cellular-level implications on sheath blight disease resistance. Gene, 561(2): 209-218.
[47]	Qiao Y L, Liu L, Xiong Q, Flores C, Wong J, Shi J X, Wang X B, Liu X G, Xiang Q J, Jiang S S, Zhang F C, Wang Y C, Judelson H S, Chen X M, Ma W B. 2013. Oomycete pathogens encode RNA silencing suppressors. Nat Genet, 45(3): 330-333.
[48]	Raghuram B, Sheikh A H, Sinha A K. 2014. Regulation of MAP kinase signaling cascade by microRNAs in Oryza sativa. Plant Signal Behav, 9(10): e972130.
[49]	Reinhart B J, Slack F J, Basson M, Pasquinelli A E, Bettinger J C, Rougvie A E, Horvitz H R, Ruvkun G. 2000. The 21-nucleotide let-7 RNA regulates developmental timing in Caenorhabditis elegans. Nature, 403: 901-906.
[50]	Rubio-Somoza I, Cuperus J T, Weigel D, Carrington J C. 2009. Regulation and functional specialization of small RNA-target nodes during plant development. Curr Opin Plant Biol, 12(5): 622-627.
[51]	Ruepp A, Zollner A, Maier D, Albermann K, Hani J, Mokrejs M, Tetko I, Guldener U, Mannhaupt G, Munsterkotter M, Mewes H W. 2004. The FunCat, a functional annotation scheme for systematic classification of proteins from whole genomes. Nucl Acids Res, 32(18): 5539-5545.
[52]	Sharma N, Tripathi A, Sanan-Mishra N. 2015. Profiling the expression domains of a rice-specific microRNA under stress. Front Plant Sci, 6: 333.
[53]	Smoot M E, Ono K, Ruscheinski J, Wang P L, Ideker T. 2011. Cytoscape 2.8: New features for data integration and network visualization. Bioinformatics, 27(3): 431-432.
[54]	Stetson D B, Ko J S, Heidmann T, Medzhitov R. 2008. Trex1 prevents cell-intrinsic initiation of autoimmunity. Cell, 134(4): 587-598.
[55]	Sun Z T, He Y Q, Li J M, Wang X, Chen J P. 2015. Genome-wide characterization of rice black streaked dwarf virus-responsive microRNAs in rice leaves and roots by small RNA and degradome sequencing. Plant Cell Physiol, 56(4): 688-699.
[56]	Sunkar R, Kapoor A, Zhu J K. 2006. Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance. Plant Cell, 18(8): 2051-2065.
[57]	Sunkar R, Chinnusamy V, Zhu J H, Zhu J K. 2007. Small RNAs as big players in plant abiotic stress responses and nutrient deprivation. Trends Plant Sci, 12(7): 301-309.
[58]	Taguchi-Shiobara F, Ozaki H, Sato H, Maeda H, Kojima Y, Ebitani T, Yano M. 2013. Mapping and validation of QTLs for rice sheath blight resistance. Breeding Sci, 63(3): 301-308.
[59]	Trapnell C, Salzberg S L. 2009. How to map billions of short reads onto genomes. Nat Biotechnol, 27(5): 455-457.
[60]	Trapnell C, Hendrickson D G, Sauvageau M, Goff L, Rinn J L, Pachter L. 2013. Differential analysis of gene regulation at transcript resolution with RNA-seq. Nat Biotechnol, 31(1): 46-53.
[61]	Vaucheret H. 2006. Post-transcriptional small RNA pathways in plants: Mechanisms and regulations. Genes Dev, 20(7): 759-771.
[62]	Wang H C, Jiao X M, Kong X Y, Hamera S, Wu Y, Chen X Y, Fang R X, Yan Y S. 2016. A signaling cascade from miR444 to RDR1 in rice antiviral RNA silencing pathway. Plant Physiol, 170(4): 2365-2377.
[63]	Wang H H, Meng J, Peng X X, Tang X K, Zhou P L, Xiang J H, Deng X B. 2015. Rice WRKY4 acts as a transcriptional activator mediating defense responses toward Rhizoctonia solani, the causing agent of rice sheath blight. Plant Mol Biol, 89: 157-171.
[64]	Wang R, Lu L X, Pan X B, Hu Z L, Ling F, Yan Y, Liu Y M, Lin Y J. 2015. Functional analysis of OsPGIP1 in rice sheath blight resistance. Plant Mol Biol, 87: 181-191.
[65]	Weiberg A, Wang M, Lin F M, Zhao H W, Zhang Z H, Kaloshian I, Huang H D, Jin H L. 2013. Fungal small RNAs suppress plant immunity by hijacking host RNA interference pathways. Science, 342: 118-123.
[66]	Wu J G, Yang R X, Yang Z R, Yao S Z, Zhao S S, Wang Y, Li P C, Song X W, Jin L, Zhou T, Lan Y, Xie L H, Zhou X P, Chu C C, Qi Y J, Cao X F, Li Y. 2017. ROS accumulation and antiviral defence control by microRNA528 in rice. Nat Plants, 3: 16203.
[67]	Xue X, Cao Z X, Zhang X T, Wang Y, Zhang Y F, Chen Z X, Pan X B, Zuo S M. 2016. Overexpression of OsOSM1 enhances resistance to rice sheath blight. Plant Dis, 100(8): 1634-1642.
[68]	Yadav S, Anuradha G, Kumar R R, Vemireddy L R, Sudhakar R, Donempudi K, Venkata D, Jabeen F, Narasimhan Y K, Marathi B, Siddiq E A. 2015. Identification of QTLs and possible candidate genes conferring sheath blight resistance in rice (Oryza sativa L.). Springerplus, 4: 175.
[69]	Yan Y, Jia H H, Wang F, Wang C, Liu S C, Guo X Q. 2015. Overexpression of GhWRKY27a reduces tolerance to drought stress and resistance to Rhizoctonia solani infection in transgenic Nicotiana benthamiana. Front Physiol, 6: 265.
[70]	Yang J, Zhang F, Li J, Chen J P, Zhang H M. 2016. Integrative analysis of the microRNAome and transcriptome illuminates the response of susceptible rice plants to rice stripe virus. PLoS One, 11(1): e0146946.
[71]	Zhai J X, Zhang H, Arikit S, Huang K, Nan G L, Walbot V, Meyers B C. 2015. Spatiotemporally dynamic, cell-type-dependent premeiotic and meiotic phasiRNAs in maize anthers. Proc Natl Acad Sci USA, 112(10): 3146-3151.
[72]	Zhang N, Yang J W, Wang Z M, Wen Y K, Wang J, He W H, Liu B L, Si H J, Wang D. 2014. Identification of novel and conserved microRNAs related to drought stress in potato by deep sequencing. PLoS One, 9(4): e95489.
[73]	Zhao Y T, Wang M, Wang Z M, Fang R X, Wang X J, Jia Y T. 2015. Dynamic and coordinated expression changes of rice small RNAs in response to Xanthomonas oryzae pv. oryzae. J Genet Genom, 42(11): 625-637.
[74]	Zuo S M, Zhang L, Wang H, Yin Y J, Zhang Y F, Chen Z X, Ma Y Y, Pan X B. 2008. Prospect of the QTL-qSB-9Tq utilized in molecular breeding program of japonica rice against sheath blight. J Genet Genom, 35(8): 499-505.
[75]	Zuo S M, Wang Z B, Chen X J, Gu F, Zhang Y F, Chen Z X, Pan X B, Pan C H. 2009. Evaluation of resistance of a novel rice line YSBR1 to sheath blight. Acta Agron Sin, 35(4): 608-614. (in Chinese with English abstract)
[76]	Zuo S M, Yin Y J, Pan C H, Chen Z X, Zhang Y F, Gu S L, Zhu L H, Pan X B. 2013. Fine mapping ofqSB-11(LE), the QTL that confers partial resistance to rice sheath blight. Theor Appl Genet, 126(5): 1257-1272.
[77]	Zuo S M, Zhang Y F, Yin Y J, Li G Z, Zhang G W, Wang H, Chen Z X, Pan X B. 2014a. Fine-mapping of qSB-9(TQ), a gene conferring major quantitative resistance to rice sheath blight. Mol Breeding, 34(4): 2191-2203.
[78]	Zuo S M, Zhu Y J, Yin Y J, Wang H, Zhang Y F, Chen Z X, Gu S L, Pan X B. 2014b. Comparison and confirmation of quantitative trait loci conferring partial resistance to rice sheath blight on chromosome 9. Plant Dis, 98(7): 957-964.

Library	Total read	High quality		3′ adapter null		Insert null		5′ adapter contaminant		Smaller than 18 nt		polyA		Clean read
Library	Count	Count	%	Count	%	Count	%	Count	%	Count	%	Count	%		Count	%
XC5	32 799 952	32 287 444	100	159 708	0.49	14 595	0.05	30 643	0.09	3 035 094	9.40	360	0.00		29 047 044	89.96
XC10	31 289 810	30 793 396	100	186 452	0.61	4 137	0.05	18 544	0.06	2 056 543	6.68	232	0.00		28 517 488	92.61
XC20	28 181 536	27 748 448	100	121 045	0.44	26 104	0.09	27 422	0.10	3 140 979	11.32	289	0.00		24 432 609	88.05
XT5	27 616 282	27 182 187	100	148 168	0.55	22 745	0.08	15 564	0.06	1 554 941	5.72	341	0.00		25 440 428	93.59
XT10	28 651 787	28 266 164	100	249120	0.88	51 729	0.18	24 077	0.09	2 284 965	8.08	248	0.00		25 656 025	90.77
XT20	32 747 097	32 299 479	100	218 084	0.68	44 324	0.14	24 153	0.07	2 488 524	7.70	309	0.00		29 524 085	91.41
YC5	30 759 202	30 341 902	100	184 708	0.61	47 254	0.16	34 138	0.11	3 415 914	11.26	214	0.00		26 659 674	87.86
YC10	27 189 430	26 824 480	100	157 101	0.59	45 378	0.17	18 941	0.07	1 628 709	6.07	211	0.00		24 974 140	93.10
YC20	27 268 095	26 892 808	100	202 043	0.75	65 279	0.24	34 931	0.13	2 768 115	10.29	229	0.00		23 822 211	88.58
YT5	30 414 313	29 998 079	100	216 264	0.72	35 100	0.12	38 493	0.13	3 363 923	11.21	200	0.00		26 344 099	87.82
YT10	27 931 541	27 555 540	100	210 300	0.76	53 864	0.20	30 147	0.11	2 737 133	9.93	151	0.00		24 523 945	89.00
YT20	26 721 361	26 354 686	100	147 538	0.56	39 329	0.15	30 794	0.12	2 958 468	11.23	154	0.00		23 178 403	87.95
Total	351 570 406	319 720 133		2 200 531		449 838		327 847		31 433 308		2 938		312 120 151

Library	Total read	High quality		3′ adapter null		Insert null		5′ adapter contaminant		Smaller than 18 nt		polyA		Clean read
Library	Count	Count	%	Count	%	Count	%	Count	%	Count	%	Count	%		Count	%
XC5	32 799 952	32 287 444	100	159 708	0.49	14 595	0.05	30 643	0.09	3 035 094	9.40	360	0.00		29 047 044	89.96
XC10	31 289 810	30 793 396	100	186 452	0.61	4 137	0.05	18 544	0.06	2 056 543	6.68	232	0.00		28 517 488	92.61
XC20	28 181 536	27 748 448	100	121 045	0.44	26 104	0.09	27 422	0.10	3 140 979	11.32	289	0.00		24 432 609	88.05
XT5	27 616 282	27 182 187	100	148 168	0.55	22 745	0.08	15 564	0.06	1 554 941	5.72	341	0.00		25 440 428	93.59
XT10	28 651 787	28 266 164	100	249120	0.88	51 729	0.18	24 077	0.09	2 284 965	8.08	248	0.00		25 656 025	90.77
XT20	32 747 097	32 299 479	100	218 084	0.68	44 324	0.14	24 153	0.07	2 488 524	7.70	309	0.00		29 524 085	91.41
YC5	30 759 202	30 341 902	100	184 708	0.61	47 254	0.16	34 138	0.11	3 415 914	11.26	214	0.00		26 659 674	87.86
YC10	27 189 430	26 824 480	100	157 101	0.59	45 378	0.17	18 941	0.07	1 628 709	6.07	211	0.00		24 974 140	93.10
YC20	27 268 095	26 892 808	100	202 043	0.75	65 279	0.24	34 931	0.13	2 768 115	10.29	229	0.00		23 822 211	88.58
YT5	30 414 313	29 998 079	100	216 264	0.72	35 100	0.12	38 493	0.13	3 363 923	11.21	200	0.00		26 344 099	87.82
YT10	27 931 541	27 555 540	100	210 300	0.76	53 864	0.20	30 147	0.11	2 737 133	9.93	151	0.00		24 523 945	89.00
YT20	26 721 361	26 354 686	100	147 538	0.56	39 329	0.15	30 794	0.12	2 958 468	11.23	154	0.00		23 178 403	87.95
Total	351 570 406	319 720 133		2 200 531		449 838		327 847		31 433 308		2 938		312 120 151

Library	miRNA		rRNA		Repeat		snRNA		snoRNA		tRNA		Unannotation
XC5	7 078	0.17%	671 405	16.02%	2 141	0.05%	12 063	0.29%	9 575	0.23%	51 491	1.23%	2 607 435	62.23%
XC10	6 790	0.16%	702 101	16.37%	2 102	0.05%	13 433	0.31%	11 867	0.28%	47 947	1.12%	2 706 094	63.09%
XC20	6 654	0.16%	558 686	13.49%	2 040	0.05%	12 297	0.30%	10 539	0.25%	50 108	1.21%	2 719 682	65.68%
XT5	7 012	0.16%	583 595	13.55%	2 270	0.05%	12 214	0.28%	10 942	0.25%	43 689	1.01%	2 802 198	65.04%
XT10	6 384	0.16%	624 579	15.83%	1 873	0.05%	11 641	0.29%	9 409	0.24%	43 291	1.10%	2 517 937	63.80%
XT20	7 323	0.15%	679 675	13.74%	2 400	0.05%	13 356	0.27%	12 086	0.24%	55 485	1.12%	3 294 453	66.58%
YC5	5 997	0.15%	539 626	13.27%	2 250	0.06%	7 605	0.19%	9 924	0.24%	36 877	0.91%	2 800 361	68.88%
YC10	5 556	0.14%	576 120	14.31%	2 181	0.05%	7 888	0.20%	9 264	0.23%	36 218	0.90%	2 781 134	69.06%
YC20	4 890	0.15%	548 609	16.81%	1 770	0.05%	8 298	0.25%	9 517	0.29%	36 568	1.12%	2 098 698	64.30%
YT5	5 628	0.15%	597 566	16.43%	1 969	0.05%	8 058	0.22%	8 766	0.24%	37 700	1.04%	2 388 685	65.68%
YT10	5 351	0.15%	564 840	15.75%	1 921	0.05%	8 072	0.23%	9 744	0.27%	41 557	1.16%	2 379 169	66.34%
YT20	5 509	0.16%	487 539	14.12%	2 119	0.06%	7 464	0.22%	8 455	0.24%	29 764	0.86%	2 318 216	67.16%

Library	miRNA		rRNA		Repeat		snRNA		snoRNA		tRNA		Unannotation
XC5	7 078	0.17%	671 405	16.02%	2 141	0.05%	12 063	0.29%	9 575	0.23%	51 491	1.23%	2 607 435	62.23%
XC10	6 790	0.16%	702 101	16.37%	2 102	0.05%	13 433	0.31%	11 867	0.28%	47 947	1.12%	2 706 094	63.09%
XC20	6 654	0.16%	558 686	13.49%	2 040	0.05%	12 297	0.30%	10 539	0.25%	50 108	1.21%	2 719 682	65.68%
XT5	7 012	0.16%	583 595	13.55%	2 270	0.05%	12 214	0.28%	10 942	0.25%	43 689	1.01%	2 802 198	65.04%
XT10	6 384	0.16%	624 579	15.83%	1 873	0.05%	11 641	0.29%	9 409	0.24%	43 291	1.10%	2 517 937	63.80%
XT20	7 323	0.15%	679 675	13.74%	2 400	0.05%	13 356	0.27%	12 086	0.24%	55 485	1.12%	3 294 453	66.58%
YC5	5 997	0.15%	539 626	13.27%	2 250	0.06%	7 605	0.19%	9 924	0.24%	36 877	0.91%	2 800 361	68.88%
YC10	5 556	0.14%	576 120	14.31%	2 181	0.05%	7 888	0.20%	9 264	0.23%	36 218	0.90%	2 781 134	69.06%
YC20	4 890	0.15%	548 609	16.81%	1 770	0.05%	8 298	0.25%	9 517	0.29%	36 568	1.12%	2 098 698	64.30%
YT5	5 628	0.15%	597 566	16.43%	1 969	0.05%	8 058	0.22%	8 766	0.24%	37 700	1.04%	2 388 685	65.68%
YT10	5 351	0.15%	564 840	15.75%	1 921	0.05%	8 072	0.23%	9 744	0.27%	41 557	1.16%	2 379 169	66.34%
YT20	5 509	0.16%	487 539	14.12%	2 119	0.06%	7 464	0.22%	8 455	0.24%	29 764	0.86%	2 318 216	67.16%

Library	Known miRNA				Novel miRNA
Library	miRNA	miRNA-5P	miRNA-3P	Target gene number	miRNA	Target gene number
XC5	450	81	80	2 690	450	9 648
XC10	441	81	68	2 296	487	8 213
XC20	415	73	72	1 524	557	9 653
XT5	444	76	79	2 132	495	8 794
XT10	427	76	72	1 929	509	12 010
XT20	454	79	75	1 579	617	11 257
YC5	411	74	68	2 584	581	4 857
YC10	405	69	70	1 846	539	8 177
YC20	402	75	61	1 804	457	6 881
YT5	420	77	70	2 303	515	7 737
YT10	403	74	70	1 888	571	8 974
YT20	406	72	69	1 834	560	5 542

RichHTML

PDF

可视化

摘要/Abstract

引用本文

使用本文

图/表 16

参考文献 78

相关文章 0

编辑推荐

Metrics

miRNA	Compared libraries	Co-expressed miRNAs ID in three time points in Venn
Known miRNA	XC/XT (3)	osa-miR1861c, osa-miR166i-3p, osa-miR408-3p
	YC/YT (5)	osa-miR1861b, osa-miR1861f, osa-miR1861i, osa-miR1861l, osa-miR1320-3p
	XT/YT (66)	osa-miR5340, osa-miR531a, osa-miR531b, osa-miR531c, osa-miR530-5p, osa-miR3980a-5p, osa-miR3980b-5p, osa-miR398b, osa-miR3980a-3p, osa-miR3980b-3p, osa-miR408-3p, osa-miR812g, osa-miR1861e, osa-miR1861k, osa-miR1861m, osa-miR1863c, osa-miR812h, osa-miR812i, osa-miR1860-3p, osa-miR1881, osa-miR444a-3p.2, osa-miR444e, osa-miR1861h, osa-miR1861j, osa-miR1876, osa-miR397b, osa-miR528-5p, osa-miR397a, osa-miR408-5p, osa-miR2880, osa-miR1846a-5p, osa-miR1846b-5p, osa-miR5814, osa-miR2871b, osa-miR167e-3p, osa-miR167i-3p, osa-miR5337a, osa-miR156d, osa-miR156f-5p, osa-miR156h-5p, osa-miR156j-5p, osa-miR535-3p, osa-miR1846c-5p, osa-miR5788, osa-miR156b-5p, osa-miR156c-5p, osa-miR156g-5p, osa-miR156a, osa-miR156e, osa-miR156i, osa-miR1846a-3p, osa-miR2106, osa-miR1874-3p, osa-miR1846b-3p, osa-miR5149, osa-miR1883a, osa-miR1883b, osa-miR1856, osa-miR1862c, osa-miR1862b, osa-miR1862a, osa-miR5807, osa-miR169i-5p.2, osa-miR5827, osa-miR2877, osa-miR1873
Novel miRNA	XC/XT (5)	novel_mir_492, novel_mir_103, novel_mir_606, novel_mir_39, novel_mir_88
	YC/YT (13)	novel_mir_2192, novel_mir_1086, novel_mir_96, novel_mir_2817, novel_mir_370, novel_mir_2307, novel_mir_2162, novel_mir_2598, novel_mir_1968, novel_mir_1228, novel_mir_2595, novel_mir_2720, novel_mir_1576
	XT/YT (45)	novel_mir_1950, novel_mir_2064, novel_mir_1962, novel_mir_2242, novel_mir_2088, novel_mir_2006, novel_mir_2225, novel_mir_735, novel_mir_1956, novel_mir_2598, novel_mir_2048, novel_mir_2817, novel_mir_2338, novel_mir_2067, novel_mir_2101, novel_mir_2164, novel_mir_1957, novel_mir_1086, novel_mir_26, novel_mir_37, novel_mir_348, novel_mir_177, novel_mir_50, novel_mir_322, novel_mir_287, novel_mir_229, novel_mir_469, novel_mir_781, novel_mir_577, novel_mir_1228, novel_mir_438, novel_mir_1872, novel_mir_478, novel_mir_316, novel_mir_328, novel_mir_468, novel_mir_717, novel_mir_492, novel_mir_174, novel_mir_553, novel_mir_137, novel_mir_273, novel_mir_113, novel_mir_810, novel_mir_382

Species	MIR821	MIR1428	MIR169_5	MIR1435	MIR1437	MIR1440	MIR1846	MIR1858	MIR2118	MIR1861	MIR1862	MIR1878	MIR1882	MIR1883	MIR1319	MIR827	MIR2121	MIR2275	MIR2863	MIR2871	MIR2873	MIR1863	MIR396_2	MIR2907	MIR3980	MIR5079	MIR5143	MIR5148	MIR5157	MIR5160	MIR5179	MIR5512	MIR5516	MIR5534	MIR5539	MIR806
Oryza_sativa	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+
Arabidopsis_thaliana	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Zea_mays	-	-	+	-	-	-	-	-	+	-	-	-	-	-	-	+	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Sorghum_bicolor	+	-	+	+	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Medicago_truncatula	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Saccharum_officinarum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Glycine_max	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Populus_trichocarpa	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Physcomitrella_patens	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Gossypium_hirsutum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Gossypium_raimondii	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Gossypium_herbaceum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Chlamydomonas_reinhardtii	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Brassica_napus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Pinus_taeda	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Selaginella_moellendorffii	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Triticum_aestivum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Carica_papaya	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Brassica_oleracea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Brassica_rapa	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Vitis_vinifera	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Solanum_lycopersicum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Lotus_japonicus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Vigna_unguiculata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Malus_domestica	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Phaseolus_vulgaris	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Brachypodium_distachyon	-	-	+	-	-	-	-	-	+	-	-	+	-	-	-	+	-	+	-	-	-	-	-	-	-	-	-	-	-	-	+	-	-	-	-	-
Aquilegia_caerulea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Populus_euphratica	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Citrus_trifoliata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Citrus_sinensis	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Citrus_clementina	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Citrus_reticulata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Ricinus_communis	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Gossypium_arboreum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Arabidopsis_lyrata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Arachis_hypogaea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Glycine_soja	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Picea_abies	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Hordeum_vulgare	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Triticum_turgidum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Festuca_arundinacea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Bruguiera_gymnorhiza	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Bruguiera_cylindrica	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Theobroma_cacao	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Rehmannia_glutinosa	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Cucumis_melo	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Saccharum_sp.	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Acacia_auriculiformis	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Acacia_mangium	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Salvia_sclarea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Digitalis_purpurea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Nicotiana_tabacum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Solanum_tuberosum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Elaeis_guineensis	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Manihot_esculenta	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Cynara_cardunculus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Linum_usitatissimum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Panax_ginseng	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Hevea_brasiliensis	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Prunus_persica	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Pinus_densata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_annuus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_ciliaris	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_tuberosus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_argophyllus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_paradoxus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_petiolaris	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_exilis	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Cunninghamia_lanceolata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Avicennia_marina	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Amborella_trichopoda	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Aegilops_tauschii	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Species	MIR821	MIR1428	MIR169_5	MIR1435	MIR1437	MIR1440	MIR1846	MIR1858	MIR2118	MIR1861	MIR1862	MIR1878	MIR1882	MIR1883	MIR1319	MIR827	MIR2121	MIR2275	MIR2863	MIR2871	MIR2873	MIR1863	MIR396_2	MIR2907	MIR3980	MIR5079	MIR5143	MIR5148	MIR5157	MIR5160	MIR5179	MIR5512	MIR5516	MIR5534	MIR5539	MIR806
Oryza_sativa	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+	+
Arabidopsis_thaliana	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Zea_mays	-	-	+	-	-	-	-	-	+	-	-	-	-	-	-	+	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Sorghum_bicolor	+	-	+	+	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Medicago_truncatula	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Saccharum_officinarum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Glycine_max	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Populus_trichocarpa	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Physcomitrella_patens	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Gossypium_hirsutum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Gossypium_raimondii	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Gossypium_herbaceum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Chlamydomonas_reinhardtii	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Brassica_napus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Pinus_taeda	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Selaginella_moellendorffii	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Triticum_aestivum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Carica_papaya	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Brassica_oleracea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Brassica_rapa	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Vitis_vinifera	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Solanum_lycopersicum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Lotus_japonicus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Vigna_unguiculata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Malus_domestica	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Phaseolus_vulgaris	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Brachypodium_distachyon	-	-	+	-	-	-	-	-	+	-	-	+	-	-	-	+	-	+	-	-	-	-	-	-	-	-	-	-	-	-	+	-	-	-	-	-
Aquilegia_caerulea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Populus_euphratica	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Citrus_trifoliata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Citrus_sinensis	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Citrus_clementina	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Citrus_reticulata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Ricinus_communis	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Gossypium_arboreum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Arabidopsis_lyrata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Arachis_hypogaea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Glycine_soja	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Picea_abies	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Hordeum_vulgare	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Triticum_turgidum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Festuca_arundinacea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Bruguiera_gymnorhiza	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Bruguiera_cylindrica	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Theobroma_cacao	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Rehmannia_glutinosa	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Cucumis_melo	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Saccharum_sp.	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Acacia_auriculiformis	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Acacia_mangium	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Salvia_sclarea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Digitalis_purpurea	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Nicotiana_tabacum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Solanum_tuberosum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Elaeis_guineensis	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Manihot_esculenta	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Cynara_cardunculus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Linum_usitatissimum	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Panax_ginseng	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Hevea_brasiliensis	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Prunus_persica	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Pinus_densata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_annuus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_ciliaris	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_tuberosus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_argophyllus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_paradoxus	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_petiolaris	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Helianthus_exilis	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Cunninghamia_lanceolata	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Avicennia_marina	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Amborella_trichopoda	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-
Aegilops_tauschii	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	+	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-	-

miRNA family	Description	Reference
miR531	Involved in MAP kinase signaling cascade	[57]
miR810	Response to drought stress	[49]
miR812	Response to H₂O₂ stress	[50]
miR814	Response to drought stress	[51]
miR815	Response to drought stress	[52]
miR820	Response to salt stress	[53]
miR1846	Response to low-N stress	[54]
miR1861	Developmental and signaling pathways	[55]
miR1862	Response to H₂O₂ stress	[50]
miR2863	Response to fungal elicitors	[22]
miR2871	Response to drought, cold and salt stress	[56]
miR1863	Required for silencing heterochromatin by methylation in rice	[58]

Pathway	Annotation	Target genes involved in the pathway
Plant-pathogen interaction (RNA-seq)	WRKY protein (6 genes)	LOC_Os01g08710.1, LOC_Os01g08710.2, LOC_Os02g43560.1, LOC_Os06g05380.1, LOC_Os11g45750.1, LOC_Os11g45750.2.
	NB domain containing protein (42 genes)	LOC_Os01g16390.1, LOC_Os02g19750.1, LOC_Os06g06390.1, LOC_Os06g06400.1, LOC_Os07g09940.1, LOC_Os07g40810.1, LOC_Os08g10430.1, LOC_Os08g10440.1, LOC_Os08g30660.1, LOC_Os08g42710.1, LOC_Os09g34150.1, LOC_Os09g34150.2, LOC_Os11g11550.1, LOC_Os11g11550.2, LOC_Os11g11790.1, LOC_Os11g11810.1, LOC_Os11g27430.1, LOC_Os11g34970.1, LOC_Os11g39160.1, LOC_Os11g39260.1, LOC_Os11g39320.1, LOC_Os11g45790.1, LOC_Os11g45930.1, LOC_Os11g45970.1, LOC_Os11g46080.1, LOC_Os11g46210.1, LOC_Os12g06920.1, LOC_Os12g09710.1, LOC_Os12g10410.1, LOC_Os12g13550.1, LOC_Os12g17410.1, LOC_Os12g18374.2, LOC_Os12g28100.1, LOC_Os03g46550.1, LOC_Os11g15190.1, LOC_Os12g37760.1, LOC_Os12g37770.1, LOC_Os05g40150.1, LOC_Os10g22484.1, LOC_Os10g22484.2, LOC_Os10g22484.3, LOC_Os11g45780.1.
	Retrotransposon protein (32 genes)	LOC_Os01g16500.1, LOC_Os01g29270.1, LOC_Os02g17820.1, LOC_Os02g18290.1, LOC_Os02g22040.1, LOC_Os02g32090.1, LOC_Os02g32880.1, LOC_Os02g41702.1, LOC_Os02g43260.1, LOC_Os02g47270.1, LOC_Os03g30990.1, LOC_Os03g62040.1, LOC_Os04g03120.1, LOC_Os04g14770.1, LOC_Os04g45420.1, LOC_Os05g31860.1, LOC_Os05g51320.1, LOC_Os06g24670.1, LOC_Os06g30110.1, LOC_Os06g39310.1, LOC_Os07g14800.1, LOC_Os07g24810.1, LOC_Os07g31170.1, LOC_Os07g40050.1, LOC_Os07g43090.1, LOC_Os07g49170.1, LOC_Os08g16530.1, LOC_Os09g14720.1, LOC_Os10g32250.1, LOC_Os11g43230.1, LOC_Os12g23374.1, LOC_Os12g25510.1.
	Stripe rust resistance protein (7 genes)	LOC_Os01g23380.1, LOC_Os07g09910.1, LOC_Os10g04342.1, LOC_Os11g15500.1, LOC_Os11g32170.1, LOC_Os11g34920.1, LOC_Os12g17490.1.
	Disease resistance protein (12 genes)	LOC_Os01g57870.1, LOC_Os01g57870.2, LOC_Os04g11760.1, LOC_Os08g07774.1, LOC_Os08g07920.1, LOC_Os08g07940.1, LOC_Os08g28470.1, LOC_Os11g12040.1, LOC_Os11g16510.1, LOC_Os11g29030.1, LOC_Os12g28250.1, LOC_Os02g17304.1.
	Resistance protein (10 genes)	LOC_Os04g11780.1, LOC_Os06g06850.1, LOC_Os07g27370.1, LOC_Os08g29809.1, LOC_Os08g42670.1, LOC_Os08g42670.2, LOC_Os08g42700.1, LOC_Os11g11920.1, LOC_Os11g14380.1, LOC_Os12g37290.1.
	Mla (9 genes)	LOC_Os06g06860.1, LOC_Os08g31780.1, LOC_Os10g22510.1, LOC_Os11g13410.1, LOC_Os11g16470.1, LOC_Os11g16470.2, LOC_Os11g16470.3, LOC_Os12g17480.1, LOC_Os10g04110.1.
	Receptor kinase (3 genes)	LOC_Os10g32990.1, LOC_Os11g35660.1, LOC_Os11g47160.1.

miRNA	Sequence (5′-3′)	Probe (5′-3′)
miR444b.2	UGCAGUUGUUGUCUCAAGCUU	AAGCTTGAGACAACAACTGCA
miR531a	CUCGCCGGGGCUGCGUGCCGCCAU	ATGGCGGCACGCAGCCCCGGCGAG
miR1861i	CGGUCUUGAGGCAGGAACUGAG	CTCAGTTCCTGCCTCAAGACCG
Novel_miR1956	UGUAUAUCUAAGAAGUAACUU	AAGTTACTTCTTAGATATACA
Novel_miR135	UUCAUCUAGUAUGAGGACGUG	CACGTCCTCATACTAGATGAA
U6	-	GGGGCCATGCTAATCTTCTCTG